Genome mining of labdane-related diterpenoids: Discovery of the two-enzyme pathway leading to (−)-sandaracopimaradiene in the fungus Arthrinium sacchari

• Fumito Sato,
• Terutaka Sonohara,
• Shunta Fujiki,
• Akihiro Sugawara,
• Yohei Morishita,
• Taro Ozaki and
• Teigo Asai

Beilstein J. Org. Chem. 2024, 20, 714–720, doi:10.3762/bjoc.20.65

• fungal natural products and biosynthetic machineries have been conducted, leading to the discovery of various new natural products and enzymes [19][20][21][22][23][24][25][26][27]. Although fungal LRDs are a biologically and pharmaceutically important class of natural products including DNA polymerase α

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

• Jon Lundstrøm,
• Emilie Gillon,
• Valérie Chazalet,
• Nicole Kerekes,
• Antonio Di Maio,
• Ten Feizi,
• Yan Liu,
• Annabelle Varrot and
• Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

• (ACACCTCGAGTTAGGGTTTGTACTGTGTCACGAACATCC). The primers contained the restriction sites (underlined) NcoI (sense) and XhoI (antisense) on their 5′-ends for further sub-cloning. PCR was performed using PrimeSTAR DNA polymerase. The purified PCR fragment of 395 bp was digested by NcoI and XhoI restriction enzymes, then ligated into pET40b

• . This plasmid was obtained by PCR using pET-40b(+) (Novagen, Merck, #70091) as template and the following primers: forward (gcccagatctgggtaccGAAAACCTGTATTTTCAGGGCGccatggcgatatcgg) and reverse (GGTACCCAGATCTGGGCTGTCCATGTGCTGGC) with complementary sequence underlined. PCR was performed using PrimeSTAR DNA

• polymerase (Takara #TAKR045A); then the product was digested by DpnI and finally transformed in NEB5α strain (New England Biolabs, #C2992H). Both gene and vector were digested by NcoI and XhoI restriction enzymes (New England Biolabs) prior to purification on agarose gel using Monarch Gel extraction kit and

Identification of the new prenyltransferase Ubi-297 from marine bacteria and elucidation of its substrate specificity

• Jamshid Amiri Moghaddam,
• Huijuan Guo,
• Karsten Willing,
• Thomas Wichard and
• Christine Beemelmanns

Beilstein J. Org. Chem. 2022, 18, 722–731, doi:10.3762/bjoc.18.72

• Kit (Qiagen) and PCR amplification of ubiA-297 (922 bp) and menA-1335 (952 bp) genes was carried out using S7 Fusion High-Fidelity DNA Polymerase (Biozym) and designated primer sequences (ubiA-297 forward 5’-CAGGATCCAGGATGTCCAATAAACTAATG-3’ reverse 5’-CGAAGCTTGTCTTAGGTAATGGCAAAAAG-3’; menA forward 5

Synthetic strategies toward 1,3-oxathiolane nucleoside analogues

• Umesh P. Aher,
• Dhananjai Srivastava,
• Girij P. Singh and
• Jayashree B. S

Beilstein J. Org. Chem. 2021, 17, 2680–2715, doi:10.3762/bjoc.17.182

• counterparts during DNA or RNA synthesis, a biological role that is crucial for cellular reproduction [2]. Most of the drugs that are incorporated in the viral DNA upon phosphorylation in vivo block the DNA polymerase enzyme. However, DNA polymerase recognizes 2’,3’-dideoxynucleosides as substrates, which are

• triphosphate substrate to bind to cellular DNA polymerase and viral reverse transcriptase [9]. The effectiveness of nucleoside analogues depends on the ability to replicate naturally occurring nucleosides, interfering with viral as well as cellular enzymes and hampering essential metabolism processes of

Chemical approaches to discover the full potential of peptide nucleic acids in biomedical applications

• Nikita Brodyagin,
• Martins Katkevics,
• Venubabu Kotikam,
• Christopher A. Ryan and
• Eriks Rozners

Beilstein J. Org. Chem. 2021, 17, 1641–1688, doi:10.3762/bjoc.17.116

Double-headed nucleosides: Synthesis and applications

• Vineet Verma,
• Jyotirmoy Maity,
• Vipin K. Maikhuri,
• Ritika Sharma,
• Himal K. Ganguly and
• Ashok K. Prasad

Beilstein J. Org. Chem. 2021, 17, 1392–1439, doi:10.3762/bjoc.17.98

Antiviral therapy in shrimp through plant virus VLP containing VP28 dsRNA against WSSV

• Santiago Ramos-Carreño,
• Ivone Giffard-Mena,
• Jose N. Zamudio-Ocadiz,
• Alfredo Nuñez-Rivera,
• Ricardo Valencia-Yañez,
• Jaime Ruiz-Garcia,
• Maria Teresa Viana and
• Ruben D. Cadena-Nava

Beilstein J. Org. Chem. 2021, 17, 1360–1373, doi:10.3762/bjoc.17.95

• -glycosylase (UNG) activation; 10 min at 95 °C to activate AmpliTaq Fast DNA Polymerase and then, 40 cycles of 15 seconds at 95 °C and 1 min at 60 °C. For the WSSV quantification, a standard curve was obtained with the plasmid DNA with the vp664 gene of 69 bp [45][51] at a 1:10 dilution factor. The

Biochemistry of fluoroprolines: the prospect of making fluorine a bioelement

• Vladimir Kubyshkin,
• Rebecca Davis and
• Nediljko Budisa

Beilstein J. Org. Chem. 2021, 17, 439–460, doi:10.3762/bjoc.17.40

• packing effect has an implication on the thermostability of the triple helix [35][98][99]. In another study, fluoroprolines were incorporated in KlenTag DNA polymerase from a thermophilic organism, Thermus aquaticus [119]. The expression of the target protein was only observed with R-Flp, but not with S

• subdomain [129], T. thermohydrosulfuricus lipase [130][131][132], human ubiquitin [133], single-chain Fv format protein [134], KlenTag DNA polymerase [135], thioredoxin A [120], β2-microglobulin [136], red fluorescent protein [137][138], Pin1 WW domain [139], bacteriophage T4 fibritin C-terminal domain [106

New standards for collecting and fitting steady state kinetic data

• Kenneth A. Johnson

Beilstein J. Org. Chem. 2019, 15, 16–29, doi:10.3762/bjoc.15.2

• is so much slower than chemistry, the initial weak substrate binding and the conformational change are the primary determinants of specificity. DNA polymerase fidelity DNA polymerases provide ideal model systems to study enzyme specificity because fidelity is high and physiologically relevant, and

• the alternate substrates are well known. Moreover, it is easy to perform single turnover kinetic measurements to examine steps leading up to the chemical reaction by mixing an enzyme DNA complex with only one nucleoside triphosphate. Recent work on DNA polymerase fidelity has shown that the rate of

• of enzyme specificity because it commits the substrate to forward reaction. For the DNA polymerase studied, the rate of product release is much faster than chemistry so the model reduces to a three-step model. Accordingly the specificity constant is defined by the two-step binding reaction, while

Protein–protein interactions in bacteria: a promising and challenging avenue towards the discovery of new antibiotics

• Laura Carro

Beilstein J. Org. Chem. 2018, 14, 2881–2896, doi:10.3762/bjoc.14.267

• to DnaG was predicted. Finally, the fragments were also assessed against other SSB partner proteins by means of STD-NMR. Although the affinity values were not determined, all of them were satisfactorily found to bind to E. coli PriA, E. coli RNAse HI and the χ subunit of E. coli and A. Baumannii DNA

• polymerase III, and thus represent promising leads in the search for PPI inhibitors in bacteria. Filamenting temperature-sensitive protein Z (FtsZ) FtsZ is a prokaryotic tubulin-like protein which plays a crucial role in cell division in both Gram-positive and Gram-negative bacteria [83]. This protein

An overview of recent advances in duplex DNA recognition by small molecules

• Sayantan Bhaduri,
• Nihar Ranjan and
• Dev P. Arya

Beilstein J. Org. Chem. 2018, 14, 1051–1086, doi:10.3762/bjoc.14.93

• activities were evaluated [102]. A molecular docking study has revealed that GRA interacts with ct-DNAs via hydrogen bonding interactions between the oxygen atoms of GRA and adenine bases of DNA and van der Waals interactions. Moreover, GRA significantly reduces the polymerization activity of DNA polymerase

Fluorogenic PNA probes

• Tirayut Vilaivan

Beilstein J. Org. Chem. 2018, 14, 253–281, doi:10.3762/bjoc.14.17

• rolling circle amplification reaction (RCA) initiated by phi29 DNA polymerase to give a long tandem repeat DNA. As low as 0.4 pM of miRNA could be readily detected with single mismatch specificity [143]. In addition to the direct detection of DNA and RNA targets, the PNA–GO platform has also been used for

Fluorescent nucleobase analogues for base–base FRET in nucleic acids: synthesis, photophysics and applications

• Mattias Bood,
• Sangamesh Sarangamath,
• Moa S. Wranne,
• Morten Grøtli and
• L. Marcus Wilhelmsson

Beilstein J. Org. Chem. 2018, 14, 114–129, doi:10.3762/bjoc.14.7

• and conformational changes using base–base FRET Many biologically important processes such as binding of transcription factors to DNA, polymerase–DNA interactions during replication, gene regulatory systems and structure variation due to changes in conditions (e.g., B-to-Z-form DNA), generally involve

Synthetic mRNA capping

• Fabian Muttach,
• Nils Muthmann and
• Andrea Rentmeister

Beilstein J. Org. Chem. 2017, 13, 2819–2832, doi:10.3762/bjoc.13.274

• of the replicative DNA polymerase from Thermococcus gorgonarius (Tgo) into a DNA-dependent RNA polymerase (termed TGK) enabled production of up to 1,700 nt long RNAs from a ssDNA template and an RNA primer [119]. The primer-dependent RNA synthesis obviates the need to initiate RNA synthesis with pppG

Towards open-ended evolution in self-replicating molecular systems

• Herman Duim and
• Sijbren Otto

Beilstein J. Org. Chem. 2017, 13, 1189–1203, doi:10.3762/bjoc.13.118

• formed and the DNA has successfully become replicated. The replication of DNA however is a complex process mediated by enzymes such as DNA polymerase and topoisomerase. To better understand the origin of life and as a possible first step in the synthesis of de novo life it would be very interesting

From chemical metabolism to life: the origin of the genetic coding process

• Antoine Danchin

Beilstein J. Org. Chem. 2017, 13, 1119–1135, doi:10.3762/bjoc.13.111

Radical polymerization by a supramolecular catalyst: cyclodextrin with a RAFT reagent

• Kohei Koyanagi,
• Yoshinori Takashima,
• Takashi Nakamura,
• Hiroyasu Yamaguchi and
• Akira Harada

Beilstein J. Org. Chem. 2016, 12, 2495–2502, doi:10.3762/bjoc.12.244

• catalyst; Introduction The folding of proteins in biological systems, the replication of DNA, and specific substrate recognition by enzymes play important roles in forming supramolecular structures, achieving functions, and maintaining life [1][2][3][4][5][6]. The crystal structures of RNA polymerase, DNA

• polymerase, and λ-exonuclease demonstrate that the cylindrical cavities of enzymes can effectively recognize substrates to produce biological polymers [1][2][3][4][5][6]. Cyclodextrins (CDs) have been widely used as substrate-recognition moieties in artificial enzymes [7][8][9][10][11][12][13][14][15], which

DNA display of glycoconjugates to emulate oligomeric interactions of glycans

• Alexandre Novoa and
• Nicolas Winssinger

Beilstein J. Org. Chem. 2015, 11, 707–719, doi:10.3762/bjoc.11.81

• enzymatically using glycan-functionalized desoxyuridine triphosphate as substrate with KOD Dash DNA polymerase [23]. The applicability of the method was illustrated with the incorporation of multiple units of lactose or maltose in different DNA sequences. The same group used this technology to prepare

Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

• Kristen K. Merritt,
• Kevin M. Bradley,
• Daniel Hutter,
• Mariko F. Matsuura,
• Diane J. Rowold and
• Steven A. Benner

Beilstein J. Org. Chem. 2014, 10, 2348–2360, doi:10.3762/bjoc.10.245

• single-stranded DNA molecules that include AEGIS components. OligArch designs these fragments so that, after they are annealed, the annealed fragments are extended by a DNA polymerase to fill in any gaps, the nicks in the resulting duplex are ligated (Figure 3 schematically, Figure 4 in detail), and the

• synthesis from six phosphoramidites (four standard and two AEGIS). They were then mixed in equal amounts, heated and cooled. The 3’-fragments were then extended at 48 °C using Phusion DNA polymerase to give a nicked construct and the nicks were sealed with ligase. The first indication that the GACTSB AEGIS

• annealed mixture were transferred to a new tube, and then diluted with a mixture of enzymes (total volume of mixture was 15 µL) containing PhusionTM DNA polymerase (1 U, New England Biolabs, final 0.07 U/µL), Taq DNA ligase (400 U, New England Biolabs, final 27 U/µL), ISO buffer, and dNTPs (final 0.2 mM

Reversibly locked thionucleobase pairs in DNA to study base flipping enzymes

• Christine Beuck and
• Elmar Weinhold

Beilstein J. Org. Chem. 2014, 10, 2293–2306, doi:10.3762/bjoc.10.239

• opposing adenine, resulting in ring opening and formation of an ethylene cross-linked base pair [29][30]. Other aziridine-substituted nucleobases have been incorporated enzymatically by a DNA polymerase, but elongation past the modified nucleoside has not been reported [31]. Another approach uses

OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS) to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

• Kevin M. Bradley and
• Steven A. Benner

Beilstein J. Org. Chem. 2014, 10, 1826–1833, doi:10.3762/bjoc.10.192

• fragments so that the target DNA is produced after the fragments are annealed, after the annealed fragments are (optionally) extended by a DNA polymerase to fill in any gaps to give nicked DNA, after any nicks are sealed, and after the AEGIS pairs are replaced by standard pairs. OligArch also ensures that

A new building block for DNA network formation by self-assembly and polymerase chain reaction

• Holger Bußkamp,
• Sascha Keller,
• Marta Robotta,
• Malte Drescher and
• Andreas Marx

Beilstein J. Org. Chem. 2014, 10, 1037–1046, doi:10.3762/bjoc.10.104

• network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel

• hydrogels. Keywords: AFM; branched DNA; DNA; DNA polymerase; nanotechnology; nucleic acids; PCR; self-assembly; Introduction DNA has found applications in the field of nanotechnology due to its inherent properties. The simplicity and predictability of DNA secondary structure are of outstanding potential

• , the formed DNA networks are remarkably stabilized (up to 95 °C) compared to the non-branched counterparts. We previously reported an approach to construct three dimensional DNA networks that were generated and amplified by DNA polymerase chain reactions (PCR). In order to construct the network we

Synthesis and in silico screening of a library of β-carboline-containing compounds

• Kay M. Brummond,
• John R. Goodell,
• Matthew G. LaPorte,
• Lirong Wang and
• Xiang-Qun Xie

Beilstein J. Org. Chem. 2012, 8, 1048–1058, doi:10.3762/bjoc.8.117

• -aminobutyric acid receptor subunit gamma-2, breast adenocarcinoma cells, 5-hydroxytryptamine receptor 6, angiotensin-converting enzyme, and DNA polymerase iota. Moreover, nine of the twelve compounds are represented by allene precursors, ones that were not originally considered in the diversity analysis

Diarylethene-modified nucleotides for switching optical properties in DNA

• Sebastian Barrois and
• Hans-Achim Wagenknecht

Beilstein J. Org. Chem. 2012, 8, 905–914, doi:10.3762/bjoc.8.103

• with a representative set of chromophore-modified oligonucleotides and found that the DNA-polymerase-catalyzed nucleotide incorporation opposite to attached chromophores at the 5-position of uridine follows Watson–Crick selectivity [49]. In the meantime, DNA polymerases have been evolved that have an

• photoswitchable components in nucleic acids and are suitable for the control of a variety of different biological functions. The photoinduced cis–trans isomerization of azobenzene nucleosides can reversibly switch between the formation and dissociation of DNA duplexes [14][15][16][17], photoregulate DNA

• polymerase reaction [18], photocontrol DNA triplex formation [19], and drive photon-fueled DNA-based nanomachines [20][21]. Concerning the extent of structural change, the cis–trans isomerization of azobenzenes behaves much simpler than the ring opening of spiropyrans to merocyanines. In the latter case not